E. Then, 1, 10 m M EDTA, 0.5% Empigen BB and 1% SDS) Chromatin was sonicated 10 min (15 s on/off cycles ) on Bioruptor (Diagenode) at highest intensity Soluble chromatin was diluted in IP buffer (20 mM Tris-HCl, pH 8.1, 2 mM EDTA, 0.1% Triton X-100) with 2 ?g of ER? antibody (E115, Abcam) and yeast RNA as non-specific competitor and incubated overnight at 4 °C on rocking platform. Then, protein G coupled sepharose beads were added to the samples and were incubated 4 h à 4 °C. Immune complexes were washed one time in washing buffer 1 (20 mM Tris- HCl, pH 8.1, 2 mM EDTA, 150 mM NaCl, 1% Triton X-100 and 0.1% SDS), one time in washing buffer 2 (20 mM Tris-HCl, pH 8.1, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100 and 0.1% SDS), one time in washing buffer 3 (10 mM Tris-HCl, pH 8.1, 1 mM EDTA, 250 mM LiCl, 1% Deoxycholate and 1% NP-40) and finally two times in washing buffer 4 (10 mM Tris-HCl, pH 8.1, 1 mM EDTA) After washing, immune complexes were extracted with 100 ?l of extraction buffer (0.1 M NaHCO 3 and 1% SDS). Cross-linking was reverse by incubation of samples overnight at 65 °C and DNA was purified using the Nucleospin Gel and PCR cleanup kit (Macherey Nagel) Enrichment analysis on the ERE proximal of GREB1 (Fwd: CACTTTGAGCAAAAGCCACA and Rev, 10 min with 1.5% of formaldehyde (Sigma). Cells were lysed in lysis buffer (50 mM Tris-HCl GACCCAGTTGCCA- CACTTTT) and on an enhancer 1 of PgR described in [58] was normalized using an irrelevant region on the chromosome 10 (Fwd: AGGTGACAAGC- CAAGTGTCC and Rev.: GCCTGGTGGCATACTAAAGG). Analysis was performed by real time PCR on a CFX 384 apparatus (BioRad) on 2 ?L of immunoprecipitation or 0.2 ?L of input with 500 nM of primers and iTaq Universal SYBR Green Supermix (BioRad). (XLSX 590 kb

, References

W. and G. , Fact Sheets by Cancer Available from

E. Levin and R. Pietras, Estrogen receptors outside the nucleus in breast cancer, Breast Cancer Research and Treatment, vol.9, issue.3, pp.351-61, 2008.
DOI : 10.1042/bj3190657

G. Kerdivel, G. Flouriot, and F. Pakdel, Modulation of Estrogen Receptor Alpha Activity and Expression During Breast Cancer Progression, Vitam Horm, vol.93, pp.135-60, 2013.
DOI : 10.1016/B978-0-12-416673-8.00004-6
URL : https://hal.archives-ouvertes.fr/hal-00874313

A. Sirotkin and A. Harrath, Phytoestrogens and their effects, European Journal of Pharmacology, vol.741, pp.230-236, 2014.
DOI : 10.1016/j.ejphar.2014.07.057

S. Lecomte, M. Lelong, G. Bourgine, T. Efstathiou, C. Saligaut et al., Assessment of the potential activity of major dietary compounds as selective estrogen receptor modulators in two distinct cell models for proliferation and differentiation, Toxicology and Applied Pharmacology, vol.325, pp.61-70, 2017.
DOI : 10.1016/j.taap.2017.04.005
URL : https://hal.archives-ouvertes.fr/hal-01558816

V. Lozovaya, A. Lygin, O. Zernova, S. Li, G. Hartman et al., Isoflavonoid accumulation in soybean hairy roots upon treatment with Fusarium solani, Plant Physiology and Biochemistry, vol.42, issue.7-8, pp.671-680, 2004.
DOI : 10.1016/j.plaphy.2004.06.007

A. Lygin, O. Zernova, C. Hill, N. Kholina, J. Widholm et al., Phytopathology, vol.103, issue.10, pp.984-94, 2013.
DOI : 10.1094/PHYTO-12-12-0328-R

R. Edens, S. Anand, and R. Bolla, Enzymes of the Phenylpropanoid pathway in soybean infected with Meloidogyne Incognita or Heterodera glycines, J Nematol, vol.27, pp.292-303, 1995.

T. Ng, X. Ye, J. Wong, E. Fang, Y. Chan et al., Glyceollin, a soybean phytoalexin with medicinal properties, Applied Microbiology and Biotechnology, vol.332, issue.12, pp.59-68, 2011.
DOI : 10.1124/jpet.109.160382

G. Nikov, N. Hopkins, S. Boue, and W. Alworth, Interactions of Dietary Estrogens with Human Estrogen Receptors and the Effect on Estrogen Receptor-Estrogen Response Element Complex Formation, Environmental Health Perspectives, vol.108, issue.9, pp.867-72, 2000.
DOI : 10.1289/ehp.00108867

M. Burow, S. Boue, B. Collins-burow, L. Melnik, B. Duong et al., Phytochemical glyceollins, isolated from soy, mediate antihormonal effects through estrogen receptor alpha and beta, J Clin Endocrinol Metab, vol.86, pp.1750-1758, 2001.

M. Zimmermann, S. Tilghman, S. Boué, V. Salvo, S. Elliott et al., Glyceollin I, a Novel Antiestrogenic Phytoalexin Isolated from Activated Soy, Journal of Pharmacology and Experimental Therapeutics, vol.332, issue.1, pp.35-45, 2010.
DOI : 10.1124/jpet.109.160382

V. Salvo, S. Boué, J. Fonseca, S. Elliott, C. Corbitt et al., Antiestrogenic Glyceollins Suppress Human Breast and Ovarian Carcinoma Tumorigenesis, Clinical Cancer Research, vol.12, issue.23, pp.7159-64, 2006.
DOI : 10.1158/1078-0432.CCR-06-1426

R. Khupse, J. Sarver, J. Trendel, N. Bearss, M. Reese et al., Biomimetic Syntheses and Antiproliferative Activities of Racemic, Natural (???), and Unnnatural (+) Glyceollin I, Journal of Medicinal Chemistry, vol.54, issue.10, pp.3506-3529, 2011.
DOI : 10.1021/jm101619e

F. Payton-stewart, R. Khupse, S. Boué, S. Elliott, M. Zimmermann et al., Glyceollin I enantiomers distinctly regulate ER-mediated gene expression, Steroids, vol.75, issue.12, pp.870-878, 2010.
DOI : 10.1016/j.steroids.2010.05.007

J. Tian, T. Berton, S. Shirley, I. Lambertz, I. Gimenez-conti et al., Developmental stage determines estrogen receptor alpha expression and non-genomic mechanisms that control IGF-1 signaling and mammary proliferation in mice, Journal of Clinical Investigation, vol.122, issue.1, pp.192-204, 2012.
DOI : 10.1172/JCI42204
URL : http://www.jci.org/articles/view/42204/files/pdf

R. Khupse and P. Erhardt, Total Syntheses of Racemic, Natural (???) and Unnatural (+) Glyceollin I, Organic Letters, vol.10, issue.21, pp.5007-5017, 2008.
DOI : 10.1021/ol802112r

A. Luniwal, R. Khupse, M. Reese, J. Liu, M. El-dakdouki et al., Multigram Synthesis of Glyceollin I, Organic Process Research & Development, vol.15, issue.5, pp.1149-62, 2011.
DOI : 10.1021/op200112g

F. Chalmel and M. Primig, The Annotation, Mapping, Expression and Network (AMEN) suite of tools for molecular systems biology, BMC Bioinformatics, vol.9, issue.1, p.86, 2008.
DOI : 10.1186/1471-2105-9-86
URL : https://hal.archives-ouvertes.fr/inserm-00521445

G. Smyth, Linear Models and Empirical Bayes Methods for Assessing Differential Expression in Microarray Experiments, Statistical Applications in Genetics and Molecular Biology, vol.3, issue.1, pp.1-25, 2004.
DOI : 10.2202/1544-6115.1027
URL : http://www.mcb.mcgill.ca/~hallett/2/limma.pdf

D. Yusuf, S. Butland, M. Swanson, E. Bolotin, A. Ticoll et al., The Transcription Factor Encyclopedia, Genome Biology, vol.13, issue.3, p.24, 2012.
DOI : 10.1111/j.1755-3768.2008.01427.x
URL : https://hal.archives-ouvertes.fr/inserm-00716041

O. Takahashi and S. Oishi, Male reproductive toxicity of four bisphenol antioxidants in mice and rats and their estrogenic effect, Archives of Toxicology, vol.61, issue.4, pp.225-266, 2006.
DOI : 10.2131/jts.19.2_77

M. Bratton, E. Martin, S. Elliott, L. Rhodes, B. Collins-burow et al., Glyceollin, a novel regulator of mTOR/p70S6 in estrogen receptor positive breast cancer, The Journal of Steroid Biochemistry and Molecular Biology, vol.150, pp.17-23, 2015.
DOI : 10.1016/j.jsbmb.2014.12.014

C. Wood, S. Boue, B. Collins-burow, L. Rhodes, T. Register et al., Glyceollin-Elicited Soy Protein Consumption Induces Distinct Transcriptional Effects As Compared to Standard Soy Protein, Journal of Agricultural and Food Chemistry, vol.60, issue.1, pp.81-87, 2012.
DOI : 10.1021/jf2034863
URL : http://europepmc.org/articles/pmc3750717?pdf=render

S. Stoll, P. Stuart, W. Swindell, L. Tsoi, B. Li et al., The EGF receptor ligand amphiregulin controls cell division via FoxM1, Oncogene, vol.1, issue.16, pp.2075-86, 2015.
DOI : 10.1093/emboj/19.18.4976
URL : http://europepmc.org/articles/pmc4788585?pdf=render

A. Bergamaschi, Z. Madak-erdogan, Y. Kim, Y. Choi, H. Lu et al., The forkhead transcription factor FOXM1 promotes endocrine resistance and invasiveness in estrogen receptor-positive breast cancer by expansion of stem-like cancer cells, Breast Cancer Research, vol.117, issue.5, p.436, 2014.
DOI : 10.1172/JCI27527

A. Boudot, G. Kerdivel, D. Habauzit, J. Eeckhoute, L. Dily et al., Differential Estrogen-Regulation of CXCL12 Chemokine Receptors, CXCR4 and CXCR7, Contributes to the Growth Effect of Estrogens in Breast Cancer Cells, PLoS ONE, vol.132, issue.6, p.20898, 2011.
DOI : 10.1371/journal.pone.0020898.s002
URL : https://hal.archives-ouvertes.fr/hal-00605459

A. Boudot, G. Kerdivel, S. Lecomte, G. Flouriot, M. Desille et al., COUP-TFI modifies CXCL12 and CXCR4 expression by activating EGF signaling and stimulates breast cancer cell migration, BMC Cancer, vol.26, issue.1, p.407, 2014.
DOI : 10.1016/S0968-0004(00)01776-X
URL : https://hal.archives-ouvertes.fr/hal-01024753

J. Couse and K. Korach, Reproductive phenotypes in the estrogen receptoralpha knockout mouse, Ann Endocrinol, vol.60, pp.143-151, 1999.

G. Kerdivel, D. Habauzit, and F. Pakdel, Assessment and Molecular Actions of Endocrine-Disrupting Chemicals That Interfere with Estrogen Receptor Pathways, International Journal of Endocrinology, vol.5, issue.3, p.501851, 2013.
DOI : 10.1016/j.mce.2007.05.011
URL : https://hal.archives-ouvertes.fr/inserm-00863365

D. Seachrist, K. Bonk, S. Ho, G. Prins, A. Soto et al., A review of the carcinogenic potential of bisphenol A, Reproductive Toxicology, vol.59, pp.167-82, 2015.
DOI : 10.1016/j.reprotox.2015.09.006

A. Wu, M. Yu, C. Tseng, and M. Pike, Epidemiology of soy exposures and breast cancer risk, British Journal of Cancer, vol.71, issue.1, pp.9-14, 2008.
DOI : 10.1038/bjc.1995.263
URL : http://www.nature.com/bjc/journal/v98/n1/pdf/6604145a.pdf

B. Caan, L. Natarajan, B. Parker, E. Gold, C. Thomson et al., Soy Food Consumption and Breast Cancer Prognosis, Cancer Epidemiology Biomarkers & Prevention, vol.20, issue.5, pp.854-862, 2011.
DOI : 10.1158/1055-9965.EPI-10-1041
URL : http://cebp.aacrjournals.org/content/cebp/20/5/854.full.pdf

B. Peano, J. Crabtree, B. Komm, R. Winneker, and H. Harris, Effects of Various Selective Estrogen Receptor Modulators with or without Conjugated Estrogens on Mouse Mammary Gland, Endocrinology, vol.150, issue.4, pp.1897-903, 2009.
DOI : 10.1210/en.2008-1210
URL : https://academic.oup.com/endo/article-pdf/150/4/1897/9007044/endo1897.pdf

L. Rhodes, S. Tilghman, S. Boue, S. Wang, H. Khalili et al., Glyceollins as novel targeted therapeutic for the treatment of triple-negative breast cancer, Oncology Letters, vol.3, issue.1, pp.163-71, 2012.
DOI : 10.3892/ol.2011.460

I. Wang, Y. Chen, D. Hughes, V. Petrovic, M. Major et al., Forkhead Box M1 Regulates the Transcriptional Network of Genes Essential for Mitotic Progression and Genes Encoding the SCF (Skp2-Cks1) Ubiquitin Ligase, Molecular and Cellular Biology, vol.25, issue.24, pp.10875-94, 2005.
DOI : 10.1128/MCB.25.24.10875-10894.2005

J. Millour, D. Constantinidou, A. Stavropoulou, M. Wilson, S. Myatt et al., FOXM1 is a transcriptional target of ER?? and has a critical role in breast cancer endocrine sensitivity and resistance, Oncogene, vol.19, issue.20, pp.2983-95, 2010.
DOI : 10.1210/me.2008-0268

P. Madureira, R. Varshochi, D. Constantinidou, R. Francis, R. Coombes et al., The Forkhead Box M1 Protein Regulates the Transcription of the Estrogen Receptor ?? in Breast Cancer Cells, Journal of Biological Chemistry, vol.57, issue.35, pp.25167-76, 2006.
DOI : 10.1016/S0092-8674(04)00298-3

Y. Horimoto, J. Hartman, J. Millour, S. Pollock, Y. Olmos et al., ER??1 Represses FOXM1 Expression through Targeting ER?? to Control Cell Proliferation in Breast Cancer, The American Journal of Pathology, vol.179, issue.3, pp.1148-56, 2011.
DOI : 10.1016/j.ajpath.2011.05.052
URL : http://europepmc.org/articles/pmc3157253?pdf=render

D. Sanders, C. Ross-innes, D. Beraldi, J. Carroll, and S. Balasubramanian,

, Genome-wide mapping of FOXM1 binding reveals co-binding with estrogen receptor alpha in breast cancer cells, Genome Biol, vol.14, p.6, 2013.

C. Yau, L. Meyer, S. Benz, C. Vaske, G. Scott et al., FOXM1 cistrome predicts breast cancer metastatic outcome better than FOXM1 expression levels or tumor proliferation index, Breast Cancer Research and Treatment, vol.37, issue.Database issue, pp.23-32, 2015.
DOI : 10.1093/nar/gkn653

D. Gilkes and G. Semenza, Role of hypoxia-inducible factors in breast cancer metastasis, Future Oncology, vol.65, issue.11, pp.1623-1659, 2013.
DOI : 10.1242/dev.083881

S. Lee, J. Jee, J. Bae, K. Liu, and Y. Lee, A Group of Novel HIF-1?? Inhibitors, Glyceollins, Blocks HIF-1?? Synthesis and Decreases Its Stability via Inhibition of the PI3K/AKT/mTOR Pathway and Hsp90 Binding, Journal of Cellular Physiology, vol.332, issue.4, pp.853-62, 2015.
DOI : 10.1124/jpet.109.160382

Q. Ke and M. Costa, Hypoxia-Inducible Factor-1 (HIF-1), Molecular Pharmacology, vol.70, issue.5, pp.1469-80, 2006.
DOI : 10.1124/mol.106.027029

H. Kim, C. Jung, Y. Jeong, and J. Kim, Soybean-derived glyceollins induce apoptosis through ROS generation, Food & Function, vol.454, issue.4, pp.688-95, 2014.
DOI : 10.1016/j.abb.2006.08.005

M. Deyoung, P. Horak, A. Sofer, D. Sgroi, and L. Ellisen, Hypoxia regulates TSC1/2 mTOR signaling and tumor suppression through REDD1-mediated 14 3 3 shuttling, Genes & Development, vol.22, issue.2, pp.239-51, 2008.
DOI : 10.1101/gad.1617608

N. Dey, P. De, L. , and B. , PI3K-AKT-mTOR inhibitors in breast cancers: From tumor cell signaling to clinical trials, Pharmacology & Therapeutics, vol.175, pp.91-106, 2017.
DOI : 10.1016/j.pharmthera.2017.02.037

P. Horak, A. Crawford, D. Vadysirisack, Z. Nash, M. Deyoung et al., Negative feedback control of HIF-1 through REDD1-regulated ROS suppresses tumorigenesis, Proceedings of the National Academy of Sciences, vol.2, issue.2, pp.4675-80, 2010.
DOI : 10.1038/nprot.2006.478

J. Mcbryan, J. Howlin, S. Napoletano, and F. Martin, Amphiregulin: Role in Mammary Gland Development and Breast Cancer, Journal of Mammary Gland Biology and Neoplasia, vol.11, issue.12, pp.159-69, 2008.
DOI : 10.1128/MCB.10.5.1969

D. Stiehl, M. Bordoli, I. Abreu-rodríguez, K. Wollenick, P. Schraml et al., Non-canonical HIF-2?? function drives autonomous breast cancer cell growth via an AREG???EGFR/ErbB4 autocrine loop, Oncogene, vol.60, issue.18, pp.2283-97, 2012.
DOI : 10.1074/jbc.M707557200

A. Müller, B. Homey, H. Soto, N. Ge, D. Catron et al., Involvement of chemokine receptors in breast cancer metastasis, Nature, vol.45, issue.6824, pp.50-56, 2001.
DOI : 10.1083/jcb.98.4.1265

X. Sun, G. Cheng, M. Hao, J. Zheng, X. Zhou et al., CXCL12 / CXCR4 / CXCR7 chemokine axis and cancer progression, Cancer and Metastasis Reviews, vol.89, issue.1, pp.709-731, 2010.
DOI : 10.4049/jimmunol.167.8.4747

H. Kang, G. Watkins, C. Parr, D. , A. Mansel et al., Stromal cell derived factor-1: its influence on invasiveness and migration of breast cancer cells in vitro, and its association with prognosis and survival in human breast cancer, Breast Cancer Research, vol.5, issue.4, pp.402-412, 2005.
DOI : 10.1186/bcr627

J. Burger, CXCR4: a key receptor in the crosstalk between tumor cells and their microenvironment, Blood, vol.107, issue.5, pp.1761-1768, 2006.
DOI : 10.1182/blood-2005-08-3182
URL : http://www.bloodjournal.org/content/bloodjournal/107/5/1761.full.pdf

M. Wendt, A. Cooper, and M. Dwinell, Epigenetic silencing of CXCL12 increases the metastatic potential of mammary carcinoma cells, Oncogene, vol.63, issue.10, pp.1461-71, 2008.
DOI : 10.1038/31269

P. Carriere, S. Llopis, A. Naiki, G. Nguyen, T. Phan et al., Glyceollin I Reverses Epithelial to Mesenchymal Transition in Letrozole Resistant Breast Cancer through ZEB1, International Journal of Environmental Research and Public Health, vol.3, issue.1, p.10, 2015.
DOI : 10.1007/s10549-012-2148-8
URL : http://www.mdpi.com/1660-4601/13/1/10/pdf

Q. Xie, Q. Bai, L. Zou, Q. Zhang, Y. Zhou et al., Genistein inhibits DNA methylation and increases expression of tumor suppressor genes in human breast cancer cells, Genes, Chromosomes and Cancer, vol.22, issue.5, pp.422-453, 2014.
DOI : 10.1186/1471-2407-10-32

J. Carroll, C. Meyer, J. Song, W. Li, T. Geistlinger et al.,

, Genome-wide analysis of estrogen receptor binding sites, Nat Genet, vol.38, pp.1289-97, 2006.