Evidence that Sry is expressed in pre-Sertoli cells and 391 Sertoli and granulosa cells have a common precursor, Dev. Biol, vol.240, pp.92-107, 2001. ,
The role of TIMPs in regulation of extracellular 394 matrix proteolysis, Matrix Biol. 44, vol.46, pp.247-254, 2015. ,
Role of matrix metalloproteinases in human periodontal diseases, 1993. ,
, J. Periodontol, vol.64, pp.474-484
Divergent vascular mechanisms downstream of Sry 400 establish the arterial system in the XY gonad, Dev. Biol, vol.244, pp.418-428, 2002. ,
Spatially dynamic expression of Sry in mouse genital ridges, 2001. ,
, Dev. Dyn, vol.221, pp.201-205
Preferential binding of collagenase to alpha 2-macroglobulin 406 in the presence of the tissue inhibitor of metalloproteinases, FEBS Lett, vol.209, pp.9-12, 1986. ,
, , p.409
Activation of beta-catenin signaling by 410, 2008. ,
, Rspo1 controls differentiation of the mammalian ovary, Hum. Mol. Genet, vol.17, pp.1264-77
, XX (B) gonads, the cells are completely dispersed and only miniscule 667 amount of ECM is present between the cells. (C) There is no positive signal in gonads 668 immunostained for AMH, both XY (A) and
, Gene expression analysis after 3-day in vitro culture of XY and XX gonad in the 671 absence or presence of MMP inhibitors (?-2-macroglobulin, leupeptin, p.672
, The expression of Oct4 ( marker of germ 673 cells), was lower in the gonads cultured with MMP inhibitors in comparison to the to the 674 control gonads and gonads cultured with APMA. The expression of testis-specific markers 675 (Sox9 and Amh) was slightly decreased in gonads cultured with MMP inhibitors, and 676 significantly decreased in gonads cultured with APMA, p.677
, Actb) show no significant changes in the gonads cultured 678 with MMP inhibitors or APMA. Relative quantitation (Y-axis) determines the changes in 679 steady-state mRNA level, follistatin (Fst) and control gene
, Table 1. Primers used for genotyping and RT-qPCR
, Gene Primers Primers used for genotyping SX (sex genotyping) F: GATGATTTGAGTGGAAATGTGAGGTA R: CTTATGTTTATAGGCATGCACCATGTA Primers used for RT-qPCR Oct4